gene 113 - KU29_BO23_6172_hyp

Gene ID
113
Name
KU29_BO23_6172_hyp
Cassette
Genbank_id
BO23
Species
Sequence
ATGCAATTCACTGCGGCAATATTTTGCATACTTCTCGCCGTCTTAGGCTTCAAATCTTTACACCTCTTCGCGACATCCAATGGATTGTTAGGGCACCTGGAGCGCATAATCACGAACAAGTCTACCCCGGCGGGAAAACCTCTACGTAATTGGACCACTGGCGGCCGTTTCCCACGGATCGATCTTCAACTCAATGCGGTTGCTACGTTCCTTCTACTCTCCTGTGAAGATTACTCAGAGCCAGATGTGAATCTTGTAGGCTTTTGGTTTGATCTATCATGGGGTCCTTCGTGGGTTCTGATTGTATTGGAGAGCTTCAGGGAGTACAGTCGAAGCCGACTGATGTCTTGGATTGCAATCCCAGGGCTCTTCATATTCAATCAGTCACACGCTGTGTTTACTTCCCTTTATCTGGCAATCAGATTGCTTGTTGCAGTTCCGGCGACCACTGAAGAAAGCCTGATGGTTGATAACATCCATCTCCATGCGATTCCCTGGAGTTTCTTATTAGGATATCTTCTGCCAATATCTCTCATGGCGCTGCCTGGAATATCCATTTATAATCTTAACACACAGCACATGCTCACCTCATTTTATCAGCAGTGGCATCTTTACATCAGTCTGGTCCATGTTCTACTGGTGACATTGTGGACCTATACAGGATCGATGGGCAGACTGGAAGACGAAAACTCCAAGGCCTCATTGTCCGCGGTCAGGCCGGTTTACGCTTTAGCCTTCTCTATGGCGGTCATCTCAGTTTGGGTTCCCATCCTTGTCTCCTTCGTCATCCGTGCACTACATCGAATCCGCAAAGCACATCCATCTAGCCAAAAGAATCTTCACATTTCCAGTATATTCATCCCACCCTCTCCATGGAGTAATATGAAATGTAAAAATGCATTTGAGGGAGGAAAATGGCTTCTCCAATGGGACGGCATAGTAGGAGGACTCAGTACCGCAGTTTGGGCAATCGCTTTATATGCTGAAGCTCGCAGTGCGGTCGAGCCACAGGAGGGATTAGGGTCATTTTGCACGAGGCTTATATGGTATATGGTCTTAGGCGGGCCAATTGGTGTTGCGACAGGAGCTTTGTGGGAAAGAGACACGCTCTTGCTGCAGTGA
Translation
MQFTAAIFCILLAVLGFKSLHLFATSNGLLGHLERIITNKSTPAGKPLRNWTTGGRFPRIDLQLNAVATFLLLSCEDYSEPDVNLVGFWFDLSWGPSWVLIVLESFREYSRSRLMSWIAIPGLFIFNQSHAVFTSLYLAIRLLVAVPATTEESLMVDNIHLHAIPWSFLLGYLLPISLMALPGISIYNLNTQHMLTSFYQQWHLYISLVHVLLVTLWTYTGSMGRLEDENSKASLSAVRPVYALAFSMAVISVWVPILVSFVIRALHRIRKAHPSSQKNLHISSIFIPPSPWSNMKCKNAFEGGKWLLQWDGIVGGLSTAVWAIALYAEARSAVEPQEGLGSFCTRLIWYMVLGGPIGVATGALWERDTLLLQ*