gene 124 - KU31_KFY69037.1_glycoside_hydrolase

Gene ID
124
Name
KU31_KFY69037.1_glycoside_hydrolase
Cassette
Genbank_id
KFY69037.1
Species
Sequence
ATGCTTCTCCTCGAATATAAGCATGGATCTGAGGCGACCAGCACGCTCACCACTTCCACCAATGTTGACACCTTTCTACTTAGCCTCCTTGACGACCGCATCATGCCTTGGGCTGTCAAAGGCAAGGAATGCCCCGCAGCTCTTACCACGAAGGTTGAGGATCTCGCCAGGGTATCGGGCACTGACCCTTTCAATGCCGCTACAGAGGCACTTGCCGACCTTGGCGAATTTCCCGGTAGCACTAACACCAGTCTGGACCTCGTTAACGATGAGAATGACGTTGTGCTTGAGAGTAATGATTGGCTCAACTGTCACAGCTGCGACAGGGTTGTTGTAGGAGGTGATGCTATGCTCAGCGTCTTCAAGGCAGCGCGTCTCCTCGGCAGAATTCCCAGCCTCGTACTCGTGGAGGGGGTGCTGGGGCTTAGGGAATGGTGTGAATGGCCAGTCAAAAGCCGGAATATCGAGCTTGTGGATAGCATTGCTACGGGTAGCAGAAAGAGTGGATCGATTCTGCTGCAAAGCTCCCAAAGCTCCCAAAGCTGCCGAAGCTGCCGAGCTCCCGGCGACGACATAGCTCTCCTACCCCTCAAAAAAGACAAGAAAAACATCACCAATGCTTTAGTAGGAAGGCGGGGTATGATTGCCGCCTGCGCAGATCCTTTCGCCTTTGGTGTCGCGCATTTAGGCAAATCGCAGAGAGGGGGAAGCACTAAGAGAACACCGCGAATAAATAGTATGGGGTTGAAGCCTAGTGAAAGTAAGACTGCCATGATTCTATGTTCGACGCAGAAAGGGAAGATATTAAGCACTGTCAGTGCTGAGGATAATACCATCGTCAGCAAATTTCTCATATATAACAGGTGGCTCGGCGTCGCTTTGTTTGCCGGAGTGGCATATACCACGCCTTCTCATCCACATCATCCTGAGTTCTTCAACAACCGCGCTATCTTCACCCCACCACAAGGAACCAAAGCTTCCTACCCCCGTATTGTCGAGTTGTCCGATGGAACAATACTAGCAACTATAGCTTGGAGGAATCCCGATGGAGACCTCCCTTATTTCCCCATATTCCAGTCCAAGGACAACGGCTGGACATGGAAGCACATCAGCAACTTAACTGACGATGTTAACGGGCTTGGTTTTGGCTCTCAGCCAGCTCTTGCCGAGCTTCCTTACAAGATGGGCAAATTTCCCAAAGGCACAGTTCTTGCCAGCGGCAACAGTGCCGGTAACACGTCGACAAACATTGACCTGTATGCAAGCCATAACAAGGGCAAGAAGTGGGAGTTCGTCAGCAATGTGGCACGCGGTGGCCGACCAAACACCACTAATGGAGCCACTCCCATATGGGAGCCGTTCATCTTGCCATATGAACACACCATGGGACTCTTCTACTCTGATCAGCGCGATCCACTTCATGGCCAAAAGCTAGCTCATCAGGAGTCAAAGGATCTCATGGACTGGGGCCCAGTGATTAATGATGTTGCATACCTAAATTATACCGATCGACCAGGCATGACATCTATTGCCCACATACCAACCGTAGATAAGTGGATCTTCACTTACGAATTCCCGGAACACGCTGGCGGCATCAACTGGTTTGGCAACCAATACCCCATCTACTATAAGATTGCCAATAACCCCCTTGACTTCCGCTATGCCGACGGCTTCCCCCTCATTGCCAGCGACAGTACCGGCAATGGCTCCCCATACGTCGTCTGGAGCTCCGTTGGCGGCGGCAACGGGACCCTCATAGTCTCTGACGCAGATACGCAGGACGTCTGGACCAACCAGGAGGTCGGTCGTCCAGACAAGTGGGTGAAGCGTCCTCAGCCGGGCAAGTCGGCGTACAGTCGCACTTTACACATTTCTCGCAAAAACCCAGACCGTCTTTACATTTTCAGCGGCGCAACGTTTGACGATGTTGCTAGTGGGCCACAGATCCCGTACGTTGTTACTGCATTGAGCGTGAAGAAGCTGCTCGCTGGTGGATACACTAATAGCGGTTGA
Translation
MLLLEYKHGSEATSTLTTSTNVDTFLLSLLDDRIMPWAVKGKECPAALTTKVEDLARVSGTDPFNAATEALADLGEFPGSTNTSLDLVNDENDVVLESNDWLNCHSCDRVVVGGDAMLSVFKAARLLGRIPSLVLVEGVLGLREWCEWPVKSRNIELVDSIATGSRKSGSILLQSSQSSQSCRSCRAPGDDIALLPLKKDKKNITNALVGRRGMIAACADPFAFGVAHLGKSQRGGSTKRTPRINSMGLKPSESKTAMILCSTQKGKILSTVSAEDNTIVSKFLIYNRWLGVALFAGVAYTTPSHPHHPEFFNNRAIFTPPQGTKASYPRIVELSDGTILATIAWRNPDGDLPYFPIFQSKDNGWTWKHISNLTDDVNGLGFGSQPALAELPYKMGKFPKGTVLASGNSAGNTSTNIDLYASHNKGKKWEFVSNVARGGRPNTTNGATPIWEPFILPYEHTMGLFYSDQRDPLHGQKLAHQESKDLMDWGPVINDVAYLNYTDRPGMTSIAHIPTVDKWIFTYEFPEHAGGINWFGNQYPIYYKIANNPLDFRYADGFPLIASDSTGNGSPYVVWSSVGGGNGTLIVSDADTQDVWTNQEVGRPDKWVKRPQPGKSAYSRTLHISRKNPDRLYIFSGATFDDVASGPQIPYVVTALSVKKLLAGGYTNSG*