gene 164 - KU36_KFY14213.1_FAD_linked_oxidase

Gene ID
164
Name
KU36_KFY14213.1_FAD_linked_oxidase
Cassette
Genbank_id
KFY14213.1
Species
Sequence
ATGAATACCACCAACATTGCCCGTGGGGCAAATGGACACGTCAAAATAAGCTCGAAATGGGACGAGATTACAGCTGTCGACCGAGAAACGTCAGAAAAGCTACGATTGGGGCTTCTACCCTCGTCGAAGAACATAGACATCAATATTCTAAACTCTCCTGGTATTGTATATCCTAGTGTATGCTCTTCTTCCGCTGTATGTCAAGTAAAGACTGTCACTACACCCTCTGCAGAAGACATAGCGGTTTCAGAAGCAATAGATGCAATTGAAGATCTTACAAGCGACTTTGAAGCTGTCACAGATGAGAGCAATACCGAGGAAGTTCCAAGTGAGCTGACTCCAAAGGTCACCAAACGGAAAAATACACGAGTTTCCAAGCTAAAATATGCCGCGGAACCTTCTCAAAAGACCCAATGGCCCCGAACCTGGTTAGGTAACGACAGCCTGTGCAACGACAAGTCTAGTCCCAAGACCATCGAATACGGCTGCAAGAATAGTCCCGCATCATCTCTGTGGACAGATAGCGAATCTTGGGATACTCCAAGCTTCCTCAGATATGATGCAGAAAGGCCCTCACGGTATCGATTTGTGCGGCCGCGCGAAACAGTTCGCCAGCGAGTTACTTCACTGAAGCATAAAGTTGTTGAAATTGCGAGAACTGATCTTGGCTGGGTGAAAGAGGCCATGGGCAACATTCGTACCAAAGCTAGCCCGGAAAATCCCAACCATAGAGTTGGAAGTGCCGAAAACTCACGCGAGAGTTCAAGAGACGACTCTACTTATTTGAGTCTGAGGGGCGGAGCGGGCGATATTTCAAGCTTGAACGGAGCGGGAAATGACATTTTTGGGATTGGCGGGGGGACTGGTGATTGTTGTGCTCAACTTTCTGCAGAGTTGGGATCCTCTGTGGGTTTTGAATTGAGCAGCATCTATGCCAACTCGCAGAGTTCGTATTGGGCAAAACAACAATCGGAGCTCACTCCAAGCTGTATTATTGTGCCTTCGACGGCGTCTGAAGTCGCGGTTGCCATCTCCATCATTTCAACAATCGAGTCGTGCAACTTCGCAGTCAAAGGTGCAGGGCACGGAACAGTTGTGGGAGCTACAAATATCAATGGAGGTGTCAAGTTTGATATGAGCCGCCTGAACGAAATTGAGACCAACTCGGAAGGAACTGTCACCAGGATCGGGGCCGGAAGCCAATGGGGAGAGGTCTATGAGTATCTTGACAACAGAGGCCTTTCCGTTGCTGGAGGTCGAAACGGCGATGTTGGCGTAGCTGGAGTGCTCCTTGGAGGCGGAATATCATTCTATGGTCCCCGAGTAGGCTGGGCAACGGATAATATTTTGAATGTCGAAGTCGTGCTTGCCTCGGGAGAGATTACCAACGCCAATTCCACTTCAAACCAAGACCTACTTAAAGCATTGAAAGGCGGGAACAGCAACTTCGGTATCGCCACATTATTTGATCTGCGCACATTCCCCCAAGGTGAAATGTGGGTGGGTTATCTCGGTCAATCCATTGATAGCCGCGATGAAGTTTTTAAAGCCATCGCCGATATCGCGTCAAATGCCAATGAGGACCCTTTCGCTGCTTTGGTGGGCGACTTCAAGTTTAATTCCGCCACCAAATCTTGGGTCATGAACCATACTGTGGCATATACAAAGCCAGTTGCCAACCCGCCGATATTTCAGCCATTGGTTAACATCAAGCCCCAGTTGAGCAACAACATTGCAATCACAAACATTAGCACCATTGCTACGGGGCAGAAGAATGGAGCCAATGTTGCTTATAACAAGAACCATCTGTCTTATACGGGCACGTACGGAAATGATGCGGCGCTTCTCTCCAAGATTTTCGACATCAGCAACGCCACCGTTCACAAGATAATGTCGCAGACCAATGGTGGGATCAAATGGACAACAATGATGGAACCATTTCCAGCGCTGGTGGACAGCTTTGGAGATAAAAACGGCGGAAACTCACTCGGTTTGAGCGCAGAGACTGGAGATCGTATTGTCATCTTGCAATTGGCACAATTTGAGGACAGAGATGCGAACGACATGGTCGACAAAGAGCTTCACAACATGTTTGAGGAGATTGCAAAAGTTGCATCGGAAATGGGACTCCTCCGCCGCTTTCGGTACTTGAATTATGCGGACAAGCAGCAGAACCCCATTGCCTCATACGGGCCGGAAAATGTGGCGCAATTGAAGGCTACAAGCAAGAAATACGATCCGAAGGGTTTATTCCAGAGACAAGCGCCTGGTGGGTTTAAGCTTGGAATGCAGCAGTGA
Translation
MNTTNIARGANGHVKISSKWDEITAVDRETSEKLRLGLLPSSKNIDINILNSPGIVYPSVCSSSAVCQVKTVTTPSAEDIAVSEAIDAIEDLTSDFEAVTDESNTEEVPSELTPKVTKRKNTRVSKLKYAAEPSQKTQWPRTWLGNDSLCNDKSSPKTIEYGCKNSPASSLWTDSESWDTPSFLRYDAERPSRYRFVRPRETVRQRVTSLKHKVVEIARTDLGWVKEAMGNIRTKASPENPNHRVGSAENSRESSRDDSTYLSLRGGAGDISSLNGAGNDIFGIGGGTGDCCAQLSAELGSSVGFELSSIYANSQSSYWAKQQSELTPSCIIVPSTASEVAVAISIISTIESCNFAVKGAGHGTVVGATNINGGVKFDMSRLNEIETNSEGTVTRIGAGSQWGEVYEYLDNRGLSVAGGRNGDVGVAGVLLGGGISFYGPRVGWATDNILNVEVVLASGEITNANSTSNQDLLKALKGGNSNFGIATLFDLRTFPQGEMWVGYLGQSIDSRDEVFKAIADIASNANEDPFAALVGDFKFNSATKSWVMNHTVAYTKPVANPPIFQPLVNIKPQLSNNIAITNISTIATGQKNGANVAYNKNHLSYTGTYGNDAALLSKIFDISNATVHKIMSQTNGGIKWTTMMEPFPALVDSFGDKNGGNSLGLSAETGDRIVILQLAQFEDRDANDMVDKELHNMFEEIAKVASEMGLLRRFRYLNYADKQQNPIASYGPENVAQLKATSKKYDPKGLFQRQAPGGFKLGMQQ*