gene 216 - KU42_PS06_4798_pyranose_DH

Gene ID
216
Name
KU42_PS06_4798_pyranose_DH
Cassette
Genbank_id
PS06
Species
Sequence
ATGCGGCGTACATTGGGAATTCTGCTGGCTCTCGTGTCGATATCCTTTGCTTCGATTCTCGAGGATGCCTCCCAGCTGGGCGAACTTGCATATGACTTCGTAGTGGTCGGTGCCGGAACCGCCGGATCCGTGGTTGCCAGTAGACTCTCCGAAGATCCGAGCGTCAGCGTGCTCCTCCTTGAAGCCGGCGTGTCTAACCAAGAGGGCCCCTTGGCACTCCAAGCTCAAGTACCCGGCTTATGCGTTGGCCTCTTGGGAACACAGTATGACTGGAACTACACGACCGTACCGCAACCCGGGCTGGGTGGAAAGAGTACTGGTTATGCTCGCGGTAAGGTTTTGGGCGGTAGCAGTACAATCAATTTCATGATCTACACGCGAGGATCTTCGGATGACTGGGATAAATATGCAGAAATCACCGGAGATGATGGCTGGTCGTGGAACGGGATTCAGAGTGCTATTCATCAGAATGAGCATTTCGTTACTCCTGCGCACTATGTCCCGCCTCGAATTGACCCTCGGGCCCACTCTTCGACGGGAGTGAACAATGTCGGGTTGAGCAACTACTCTTGGCCCGCTGACACGCGTGTATTGGAAACAGCGTACGACCCGCATTCTGGGTTCCCGTACAACGCAGACATGAACAATGGGAACCCTCTAGGCCTTGGGTGGTGTCAAGCAACCATTGGCAACGGTACCCGGAGTAGCTCAGCGGCTAGCTACCTATCGGCCGATGTCATCGCACGCCCAAACCTGGATGTTCTGCTGCACGCACAAGCCACGAAACTCTTGACCAACGGTACTACTTCGGATGGTGTACCGATTTTCACATCGGTCGAATTTGCATCCAACCGTACAGCCACGAGACATGTTGTCATCGCGAAGAAGGAAATCATCGTATCGGCAGGAACGTTCAACACGCCTCAGATCCTCTTGCTTTCCGGAATCGGGGAGGCCCGGTCGCTGTCCGTGCTCAACATCTCCACCATCATCGACTTACCCGACGTAGGACAAGGCGTATCCGATCACCCGGTTCTTCCAGCGCAGTGGACTGTGAAGCCGCAGCGGACATTGGGAACGTTCCTCGACGATCCGGCAAACCTGACCGCCGCGATGGCCGAGTGGAATAATACTCATCAAGGGCCGCTGAGTTTCACTATCACTCCCCAGCTCGGTTGGAAGCGATTATCCGATGACGACCCGCTTCTTCAAAACGTCAGTGACCCTGCTGCTGGACCCAAGTCTCCCCATTTCGAGCTTCTCTTCATACCTGGGCTTGCCGGAGGGACTCCTCCTGGCGAGAGCTTTTTCAGCATTGATTTTGTCGTCGTGTCGCCCACCTCACGCGGATCTGTGTCGCTCAACACGTCTGACCCGTTCGATCAACCCTTGATCAATCCCAATCTTCTCGGTACGGATTTCGACGTAGGCGTAATGACCCGAGCACTGGAGTCTGCGCGTCATTTCGTGGAAGGGGATCCAGTAGCGTGGAAGAGCGATATGGCTGCTGAGTTCGGTGGTTTCTCGAACGCAACATCAAGCGAAGCTATGTTGGAGTACATCCGCAGCAATTCGGACACTATATGGCATGCTGTGGGCTCGGCACAAATGAGTGCACGTAACGCAACCACGGGCGTCGTTGATCCGGATCTAAAAGTCAAAGGTGCAAAAGGTCTCCGTGTGGTCGATGCCAGTGTTTTTCCTTTCGTCCCTGCCGCCCACACGCAAGCACCAGTATACGTTGTCGCGGAACGCGGTGCGGCCATGATCAAGTCGGACTGGAATTTGGCGTAG
Translation
MRRTLGILLALVSISFASILEDASQLGELAYDFVVVGAGTAGSVVASRLSEDPSVSVLLLEAGVSNQEGPLALQAQVPGLCVGLLGTQYDWNYTTVPQPGLGGKSTGYARGKVLGGSSTINFMIYTRGSSDDWDKYAEITGDDGWSWNGIQSAIHQNEHFVTPAHYVPPRIDPRAHSSTGVNNVGLSNYSWPADTRVLETAYDPHSGFPYNADMNNGNPLGLGWCQATIGNGTRSSSAASYLSADVIARPNLDVLLHAQATKLLTNGTTSDGVPIFTSVEFASNRTATRHVVIAKKEIIVSAGTFNTPQILLLSGIGEARSLSVLNISTIIDLPDVGQGVSDHPVLPAQWTVKPQRTLGTFLDDPANLTAAMAEWNNTHQGPLSFTITPQLGWKRLSDDDPLLQNVSDPAAGPKSPHFELLFIPGLAGGTPPGESFFSIDFVVVSPTSRGSVSLNTSDPFDQPLINPNLLGTDFDVGVMTRALESARHFVEGDPVAWKSDMAAEFGGFSNATSSEAMLEYIRSNSDTIWHAVGSAQMSARNATTGVVDPDLKVKGAKGLRVVDASVFPFVPAAHTQAPVYVVAERGAAMIKSDWNLA*