gene 220 - KU43_KIJ60886.1_PKS

Gene ID
220
Name
KU43_KIJ60886.1_PKS
Cassette
Genbank_id
KIJ60886.1
Species
Sequence
ATGGCACACAGGCAACCTCTAGACAATGTTGCTCGGGATGCCCCCAGCTACACAAATCCAGACCCTCGTGCCGTAGCTATCGTCGGCATGTCTATCAGCGCGCCCGGCGGTGTTGACTATGGTCTTGATACCGAAGAATTCTATGCTTTCCTCCAAAATAGAGGATCTGCCATCATTACCGTTCCTACTAACCGCTGGAACGCGGAAGCCTTTCATGGCACTGGGCCGGGCAAGATCTCTACTACAAAGGGAGGGTTTATTCCTGACATTAGATATGCCGACCTCCAAGAGTTCGGTATTACTCCTGTGGAAGGCCAACAGATATCTACTTGCCAAATGCTTCTGCTCCATCAAGCGTTCACGGCGTTGCAGCGCAGTGGAGTTGATTATCGTGGTACAAACACTGGGGTTTACGTTGGCTCCGCATCCGGCGAAGGAACTTTGTTTGAAATGGACATAGCACAGGCAGGCCCGTATTACATGACTGGAACAACCAACTCGATCGTTGCGAACAGACTGAACTACGTATTTGATCTACTCGGTCCTTCCATGCCCATAGATACTGCGTGTTCGTCCTCGCTGGCAGCGATGCACGTCGCCGTTCAAGCCGTCCGCAACGGTGAATGTGACCAGGCTGTAGTGGCCGGTGCCAACGTCGTTCGAAACGCACTCGAATGCGTAGCGTTCAGTCAGTTAGGTGTGCTCAGCCCTGACGGCATATCCAAGTCCTTTGATGAAGATGGGAATGGATACGCACGTGGTGACGTCGCCAGCGCGGTTGTTATTAAGCGCCATGATCTCGCCGTCAAAGATCACAATCGCATTCACGCGACGCTTGTTGGTACCGCCCTGACATCATGCGGATCCATCATGGGTTCCCTCACAACCCCGAGTCCCGAAGCGCAGGCTTCGGCGATCCAGCTTGCATATCGAGACGCCGGTCTTGAGCCTCATCAAGCAGATTTCGTCGAGCTCCATGGCACGGGCACGGTTGTCGGTGACGCGACAGAAGCGAATAATGCCGGCGCCGTCTTTGCGGGAGGGAGAGATGCAAGGGAGATCCTCATTGGATCGGTGAAGAGCAACGTTGGACATGGTGAACTAGGCGCGTATATGACATCATTAGTGAAGGTCGCAATGATGTTGGAAAGGAAGGAAGTCCTACCTAATGGCTACTTCAAAAAGCCATCCTCCCGAATTGATTTCGAAAAGTTCAAGCTGCGTGTTCCCGTGTCCGTTGAGAATTTCGCACCTGGCAATCCCCAACTCGGTCGGATTGCGTCTATATCTAGTTACGGATTTGGAGGCGCTCTGTCGCTGAAGGGATGCGTTACTCTCAGCGAGAAATACAAAGAAGAGTGCGCTGAAGTTGAGCCTCTCGCCCTGTGCGAGCACTTGGCAAACCGTACACGCCAACTCCCATGGAGGTCCTTCGCAATCGCTGGATCCATCGAGACAGCGACGTTCCCCGAACCAGTCCTCGTACCTAAACGCCCCCATCCTCTCGTCTTTTGTTTCTCAGGCCAGGGCCCCCAACACTGGCAGCAAGGCCGGGAGCTATATCATACTTTCAAGGTGTTCCGCGATAGTATCAATGACTGCGACAGGGTGCATGTCGATTACACAGGGGAATCCTTCATCGAGACGACAGGCCTGTTCAAGACCGATGCTCCTAAGGACTCGGACCTGGCTACCAGCTTAACATGGCCTTCCGATGTCACTTCCATTTCTCTCACCTTCTTCCAGATTGCGCTCTTCGACCTCTTGAGTTCTCTGAATCTTAAGCCAGATACAATTGTTGGACACTCAGTTGGAGAGACAGCAGTCTTATACGCTTCAGGCGCGGTCCCACGTAGCATGGCCGTTAAAATCGCGATCGCTCGTGGAAAAGCTCTTGCCATGGTTGACAACACTGGCGGCGGTATGGTGGCTGTTTCTGGATGCGACGCAGACAAAGTACGCGACTACGCGGAAACGGCAATTACACTAGCTGTGCAGGAAGTCGACTCGGCGGGTGGTCCCCAGCTGTTCCTTGCGTCATTCAACAGCCCCACAGATATAGGCGTATCAGGCTCCAAGAAACATCTTGAGGTATTTGCAAGCTTCATCGAAAGATGGGTGAGCGATGTCGTCGCGCGCAAACTTCGCATCAACACCGCTGTCCACTCTCCCTTCGTCCATCCCTGCGAGTCGCAATACCGCCGCGACCTAGCTACCATTTTCGCGGAGTATCCAGGTCCTCACATCCCAAAGATCCCGACGATGTCCACGGTCACTGCTGAGTTCAAAACAGACTCGTATACGCCCGATTATTTGTGGAACAACCTCCGCCAACCTGTGCTTTTCTCTTCGGCTATCCCCAAAGTAGTTGAGAGACTCGGAGAATTGACCACGTTTATTGAGGTCGCCCCTCATCCAGTCCTGTCCCAGTACCTCAAGCAGATGGGTGCCCTTGATGCTCTCGCCTGCAGCAGACGTCCACCGTCTGCCCGCCATGTAAAACCTGGGTCGAGCGCTTTGGTCGAAGTACGCACATTGCTGGAAGTTTTGGGACGTTTGCTGTTAGTCGGCGTCAATAAGATCAACTTCTCGGAGTTTGCCGGATGCCCAGATGCAAACATCGAGGGTCCCGCATATCCGTTCCAGCCAAAGTTATGGCGCTATGGCATGGATGAACCATCATACGTCCGTAAGCTATTACCCGCGGAAAGGTCTTTGAATTCGATTCGGCTACGCGTCAGCCCAATTATGCCCGAGCCGTGGATGGGTGATCATGTCATTGATCATACGAATCTGGTTCCCGCGGCTGCCTACCTAGAGATGGCCCTTGAGTTCCCCGATGTTACTCAGCTGTATGATTGCCGCTTCGAGGCTATGTATGTCCTGGAAGAGTCAGGACCACCTGGGACATTGGAAGTTTCCCGGGAAGGGAATTCCTGGTGGGTGAAGTCATCATCTCAGATGCGCACTCCGCAGGGGGACAAGGAGTGGACGAGGACTGGTCCTTCTTTCGACACTCTCCACTCTTGCGGCAAGTTGGGTTATGGTCCCCCTGAAATCGAGCCGGATGCGATCACACGCGTCGATCTTGAGGAAGTGCTGTCTCGCTGCCCCTACACGTTCGATCGCGACGCCTTTAACGATCGGATGGAGGGTGTGGTACAATTTGGTCCCGAGTTCAGACGAATTATGAAAGCGGTGTGCAATGAAAAGGAAGTCCTGACATATATCAAGGGTCATGTGGATGGCCTGAATCAGACAGATTATGCCTTCCATCCCGCCCTCTTAGATGCCGTCTTCCAGTCGCCTCTTTCATGGGGCCTGATCGGTGATAAGCTGCATCTCGGTAGGAAGAATACCCAGCTACTGCTGCCACATTCTGTTCGCCGCATATTCCGCAATGATGGCAGTACTGCTCCACTGGTGCTGCCTGATGAATTTGTAGCTTATACCGTCCTCCACGAGTGGTCGCCTCACCACTGGGTGACGAACTGTTATATCTTAGGTGAAGACCAGTCGGTCATATATACCGTGGAAGGACTTCGTTTTGCGTTGGTCCAGCATGACAATGAGTGGCCTAGCGAACACTTCAAGATGTTCTGGCAACCTAGGGACTTGCCACAGTCGCATCTGGAAAGCTCAGTCATTCTTCCTGGTCCACCACCGCATTCCGATGATATAGAGTTATTTGGTCTACCTCACGACTTCGCTCCTACCTCGCCTGACCGCCAGCGCTACTTGGCTTGGGCAAATGCGGTGGCCACCAGACTGACCGCGAACAACGCTGATGTGCCAGCAGTCCCTGCTCATTTGCAAGAAAAGTATAAAGCTTTGTTCGACCTGACTCAGAGGGTCGGTGCTGGACAAAAAGCTGCCGCCGTTGAGCTGCTTTTCTATGACGACATCATGAGCAAGATCTACGAGCATCCACCTTTCATCGGCTCTGTATTCGATGCGACCACGTCGCGTTTCATCGACCTTGTTACCGACGCACTCAATGCTGGCAAACAGGTGGTCCGAGTCCTTGAGGTTGGTGCGGGAACTGGGAGGTTCACTGCACTGCTCGGGCGAGCTCTTTTGGAAGCTGCTTTGCCTGAAGGCTGCTACGTCGACTACGTCTGCACCGACGTCAGTATTTCGCTCGCACAAGAGGCGACAGCGAAGTCCCCTTGGCCAACGGTAACCGCCAAAGCCCTTGATCTGAATGTCGCGATCAGCGAACAGAACCTAGATCCCCGCAGTTTCGATATTGTCGTTGCCTTTGATGTTCTGCACGCTATCCCTGACATTCACGCGAGTTTGACGACGCTCCAGCAGCTCCTCTGTCCCGGCGGTCACATTGCCATCTTGGAGTTGGACGGTGGTTCCAAACCTGTACTGCTCCGACACTTCACCGCTGGAGGGGAAGTTGCCCTTGTCGACTTCATATCATCGCTGGATTCAACATACCCCTACCTCTTCTGGCTATACACCACTACTTCCCCCGGCGATGCAGCTGCGGTTGGACTAGTGAGAACTCTCCGCCAGGAATACCCAACCTGGAAGATTCACCTCGCTCTCTTCCCCGACTCCTGGACGGTGACAGCCCAAGAGGCTTATGTGCACTCACAGCTCATACTGTTGCCGTGGGTGGACTCTGAAGTGATGATTGACCAGGACGGGAAGATGCACGTGCCGCGTCTGGTGAAGGCCTCTCCCGCCGCTCGCCAGGAACTTCGGGGCTCTCATCCAGTCTCATTCCGGGGTTCCGATGTCTGGCGAGCGTACCCAGCGGAGCTTGGTCCGAATGATGTTGAAGTGTCCGTTCACTATGTTGGATTGACTCCGGCTATGTCTGGATGGACCGAATTTGCTGGAGCGGTGACAGCCGTCGGCTCTGGTGTACTTGAAGAGGACCTCGTCGGGCGCAGGGTATTTGGTGTTACTGTTTCTGTCCCCGGAAGTACCATCGTCTGCGATCGTTCCAAGCTTGCGTTCGTTCCTCAAGACATGGAAACTGCCCTGGCCACCGCTTTGGTGGGAAGGCTTATGTTCTTATCATTGGTCGTGGTCGATACCGTCGGCACCTCTTCGAAGAACACAAAGGTCCTCCTCCACGCTGGCCATTGTTCACCGGCCGCGCTCGCGACATACGCTTACCTAAGTGCCAACTCCTTCAACGTTACTGTCACCGTCAGCGATGCACCACCGTCCACCAACACCTTCAGCACGCTGTCCCCGATTTCATCTTCCAAATACTATGCCTGGTCATCTCGTGTCCGCGCTTGGGCTCCACGAGGCGTAGACGTCGTCTTCAATTTTGACGAGGATATCAACGTGGCGAAGCAAACGCTTTCCTTGCTTTCTTCTCGGGGGAGATTTGTTCAAATAGGGGGAGAGCTGCCCAGCTCTCTTCCTTCCGGACGTCGCTACGTATCAATCGAAGAGCATGCTGTTCTAGAAGCTGGCAATGATCTCGATCGCACCGACGCTGTTTTTTCACCCGCTGTCCTTGCTGCCCTACCTCCTGCCGTGGACATTTACAACCTCCCACAGCTCATGACCGCCGACGTCCAAGCACGCAACTCGATGCCAGGCCGTGTTACTCTGGTCGACCTGCAAGCGATTCCCCAGGAGCTTCCCGTTTTGAAAGCCGGAATGTTGAAAGGGACGGCTGTTTTCAATCCTCGAGCATCCTATGTGATTGTGGGTGGTATTGGCGGACTGGGTGTCAACATTGCACGGTGCTTGGTGGAAAATGGTGCCAAGCACCTGATTCTGACTTCGAGATCTGGGGAGAAGGGAATCGCGACTATGCAACTAGCACGCGAGAAAAAGATTGTCAATTATCTTCGAGGAATTCCTGGAGTAACCGTCGATCTTCGGGCGGTGGACGTTCTTGACGCTGAGAAGACCAGAGACTTGTTCATGAACCTGGAGCATCCTGTTGCCGGGGTGTTCTATTTGGCTGTCAGGCTCAACGACCAGGTCTTTGCGAATTTGAAGACGGAGGAAGACTGGAAAATTGGCAAGTCGGCTATCTTGCGCTTTATTTACGACGTCAAGATCAAAGGCGTTGAAGTTCTCCTGCAAGCGGTCAACCCTCAGTCACTGGATTTCCTTGTCCTCACGAGTTCCATGGCTACTGTGTGCGGCTCGCCAGGCCAGGCGAACTATTCTGCTGCCCAGACCTACATGGAGACTATGGCGGCAGCGCTTCCCAATACCGTTGCAATCACCGTGCCCCCTATCACCGATGGAGGTGTGTTTGTCCGAAGCCTGCCTCCAGGTAACGCACGCAATGCAGCCCTGGACAAATACAAATCCCTCGGAATGACTGGCTACCTTGTTGCGCAACACTGCGTGAATGCCATCTGGACGCTGAACTGCGATGCCTATAGCCCAGTCTATATTCCTCCCACCGACTGGAAAGAGATCATGCAACTTGGCATCCCGGAATACCACTTGTCGTCCCTGCGTCATTTGTTGACCAAGCAAAACGTTGAGATCGCGCTGGCAACCGAGGAGTGGTCCATTCGGGCGGCGTGCGCATCGGTGTTGGCTCTTGATACCAACGAGGTTGCAGACAATGTCCCGCTTTCAAGCTATGGTCTTGACTCGCTAACATCCGTTCGATTGAGTGGGATTCTCAAAACCAACTTCAATGTTTCCGTGACTCAGCTTCAGCTTCTCGGAAACAGTATGACTGTCCAACGACTGATGGCTCTGCAAGAGGAGCTGAAGGCCGATTCATCTTCTGTGGCTGTGGGGACTGCCAACAAGGACTCGCTCGACATACTGGGAGCCGAAGGTGTCCATCATGCTGACATGGACAAGACGATCGTTCGATTGAACAACGTCACGGATGGACAACCTGTATTCATCGTACACGGCGCTGGCGGCGGCGTCCTCGTCATGCTGAAAACCGCGGAAATGATGTCTTGTCCTGTTTATGGTGTCCAAGACACTCCAGATGCGCCCATTACCGGAACCCTCGACAAACTTTGCAGGTTCTACCTGGAGAAAATCCGAGAGAAGCAACCCAAAGGTCCATACCGCCTTGGGGGTTTCTCATTCGGCACCTATGCCGCTTTTGTCATCGCACAGCTGCTGCAAGAAGAAGGGGAGACAGTTGAGCTGCTCGTCATGATCGATGGGTCGCCAGCGATTTTCACCAACTTCGCCAAGAGGATCAATGTGACCAATATGCGAGACGAAATCATGACCGTTATCCGTGATCTTGCCGCAAGCGGGACGCTGGAAAGTGGCGAGGAACTTACCGCCATGTTTGAGGACCACTTCAAGCAAGTTGCGCAGGGCGGTTCTAGCGGCAAATTTGTGTCCCAGTTCGGTCGTGCATTCGTCGCACACGTGCTCATGGCGGTCCGCGCTTGTATCCCAGCGATCTTACGGGAGCAAGCTGGGGAGATCGATAACTCTGTCTGGCCGACCGCGAGAACGGTCGTTATCCGTGCGGAAGATGGCATTGGTCGTCAATCCGTGTCGGAAGGACTTTCCCCTGCTTTTGATGTAGAATTACGCGCCCCAGATGCGGAGTTTTACATCCTACCGGGAACGCACTTCGGGATTCTCCACCCCCAGTCTGGGCTCCCTCAGCTTCTCGAACAGGTGGAGAAGTGTGATCACCCAAAAGTGATACCACCGACGATGACGATGATGACCGGAACTACGATTTCTGTGGGAAAACACAGAAGTCAGTCATCCATCGACTTAGGCTGCTCTGACACGGCGAGGGCACAAGCTGCGAAAGAAGTTTCCGGGATCATGGTGTCATCAATGTGGAGGAGCTGGACAGCGAAGAGCACCAAGGGTGTGACAGCTTCGGCATTCTCAGACAGCATCAGGGTTTCCGCCTACAATGCGTCCCCCAGTAGGCTCCTGCTGCCTTCATTGGGGGCTAATGCAGGCCCTCAATGCGACGGCGGACGAAAATGGTACCAGGCCCCAAAAATGACCTAG
Translation
MAHRQPLDNVARDAPSYTNPDPRAVAIVGMSISAPGGVDYGLDTEEFYAFLQNRGSAIITVPTNRWNAEAFHGTGPGKISTTKGGFIPDIRYADLQEFGITPVEGQQISTCQMLLLHQAFTALQRSGVDYRGTNTGVYVGSASGEGTLFEMDIAQAGPYYMTGTTNSIVANRLNYVFDLLGPSMPIDTACSSSLAAMHVAVQAVRNGECDQAVVAGANVVRNALECVAFSQLGVLSPDGISKSFDEDGNGYARGDVASAVVIKRHDLAVKDHNRIHATLVGTALTSCGSIMGSLTTPSPEAQASAIQLAYRDAGLEPHQADFVELHGTGTVVGDATEANNAGAVFAGGRDAREILIGSVKSNVGHGELGAYMTSLVKVAMMLERKEVLPNGYFKKPSSRIDFEKFKLRVPVSVENFAPGNPQLGRIASISSYGFGGALSLKGCVTLSEKYKEECAEVEPLALCEHLANRTRQLPWRSFAIAGSIETATFPEPVLVPKRPHPLVFCFSGQGPQHWQQGRELYHTFKVFRDSINDCDRVHVDYTGESFIETTGLFKTDAPKDSDLATSLTWPSDVTSISLTFFQIALFDLLSSLNLKPDTIVGHSVGETAVLYASGAVPRSMAVKIAIARGKALAMVDNTGGGMVAVSGCDADKVRDYAETAITLAVQEVDSAGGPQLFLASFNSPTDIGVSGSKKHLEVFASFIERWVSDVVARKLRINTAVHSPFVHPCESQYRRDLATIFAEYPGPHIPKIPTMSTVTAEFKTDSYTPDYLWNNLRQPVLFSSAIPKVVERLGELTTFIEVAPHPVLSQYLKQMGALDALACSRRPPSARHVKPGSSALVEVRTLLEVLGRLLLVGVNKINFSEFAGCPDANIEGPAYPFQPKLWR