gene 96 - KU27_AN22_1469_amino_oxidase

Gene ID
96
Name
KU27_AN22_1469_amino_oxidase
Cassette
Genbank_id
AN22
Species
Sequence
ATGCAGCTCTCATTGTTGGCTCTTCTTGGAGCATTGGCGCTGCCCAGCGCTGCTGTTCCCCATGCGCGCGATGAGGGACAATGCAAGCAGACCACTGTTGCTATTCTTGGTGGAGGAATGGCTGGTATTGCTGCTGCTCAAACGCTGCACAATGCCTCCATGGATGACTTCATGATCCTCGAATACCGCGACACCATCGGCGGTCGCGCCTGGCATAAGCCCTTCGGTCAGGACAAAGATGGGAACCCATACATCATTGAGATGGGTTGTAACTGGGTCCAAGGACTCGGCACTCCTGGGGGTCCGCAGAACCCCGTCTGGACACTGGCCCAAGTCTACAACCTCTCCACCATCTACTCCAACTACAGCAACGTGTCGACCTACAACCAGCACGGCTACAAAGACTACTCCCACCTGATCGACACCTGGGATGACATCTACGACACCGCCGCCGCCCAAGCCGGCGTCATGCTCCTCGACAACCTGCAGGACCAGACAGCCCAGACCGGACTGGCCCTCGCCGGCTGGCGCCCCAAGGTCGACGACATGGAAGCACAAGCCGTTGACTGGTGGTCATGGGACTTCGAAGACGCCTACACGCCCCTCGAAAGTTCCTTTATCTTCGGCGTCGCAGGCCAAAACCTCACCGTGAACGGCTTCAGCGACGAAGACAACTTTGTCATCGACCAACGCGGCTACAGCCACATCATCCACGGCATGGCGTCGACCTTCCTCAAGCCCAACGACACTCGCCTGCTCCTCAACAACCACATCACCAACATCAGCTACTCCGACTCCGGTGTGACCGTCCACAGTTCCGACGGCTCCTGCGTGCGCGCCTCCTACGCCATCTGCACCTTCAGTCTGGGCGTATTGCAACACGACGCCGTCACCTTCACCCCGTCCCTGCCCGAATGGAAGAAAGAAGCCATCGAAGGCTTCACAATGGCCACCTACACCAAGATCTTCCTCCAGTTCAACGAGACCTTCTGGCCCGAAGACACCCAATACTTCCTCTACGCGGACCCCTACATGCGCGGCTACTACCCCGTCTTCCAGTCCCTCAGCACCGAGGGCTTCTTCCCGGGCTCCAACATCATCTTCGTCACCGTGACGGAGCAATTCGCCTGGCGCGCCGAACGCCAGTCCGACGAGAAGACCAAAGCAGAGGTGATGGAAGTCCTGCGCAAGATGTTCCCGGAGAAGGATATCCCTGACCCGATTGCGTTCATGTACCCGCGGTGGACCCTGGAGCCATGGGCTTACGGCAGTTACTCGAACTGGCCGCCCAGCACGACGTTGGAGATGCATGAGAACCTGCGTGCCAATGCGGGGAGACTGTGGTTTGCCGGTGAGGCAACCAGTCCAACCTACTTTGGGTTCTTGCATGGAGCTTGGTTCGAGGGCCAGGCTGCGGGGCTTCATCTTAGCAGTATCTTGAACGGCACTTGCAAGGCGAATACTACTTGCAAGGGCAGGAAGCATTACGAGACGTTGCACGGCACGACGCCATTGTCGGATTACAGCTTCGTGGATGGATGGAACGGAAACAGTTTCTATGATTTTAACGATGATTAA
Translation
MQLSLLALLGALALPSAAVPHARDEGQCKQTTVAILGGGMAGIAAAQTLHNASMDDFMILEYRDTIGGRAWHKPFGQDKDGNPYIIEMGCNWVQGLGTPGGPQNPVWTLAQVYNLSTIYSNYSNVSTYNQHGYKDYSHLIDTWDDIYDTAAAQAGVMLLDNLQDQTAQTGLALAGWRPKVDDMEAQAVDWWSWDFEDAYTPLESSFIFGVAGQNLTVNGFSDEDNFVIDQRGYSHIIHGMASTFLKPNDTRLLLNNHITNISYSDSGVTVHSSDGSCVRASYAICTFSLGVLQHDAVTFTPSLPEWKKEAIEGFTMATYTKIFLQFNETFWPEDTQYFLYADPYMRGYYPVFQSLSTEGFFPGSNIIFVTVTEQFAWRAERQSDEKTKAEVMEVLRKMFPEKDIPDPIAFMYPRWTLEPWAYGSYSNWPPSTTLEMHENLRANAGRLWFAGEATSPTYFGFLHGAWFEGQAAGLHLSSILNGTCKANTTCKGRKHYETLHGTTPLSDYSFVDGWNGNSFYDFNDD*