Terminator 18

Terminator ID
18
Name
AN5579t
Type
terp
Sequence
AAAAGCCATGCCTTCGTGATGATGTTATGCTAGGAAATCCACTAGGTGAAAAAAACATGGAGGGCTTGCATGACCGACGATGCCTTTGTGTATCTGGGTTGAGCCTCACACCAGTACATAATTCTCCATTTTCTGAGGTTGTATGAACTTAAACTTGCATGTATATAGATATGACTTGTTAGTCACCTCTAATGGTTTAATGATTTATTCGCCATCCTATATATTGGACATACTTACCCTCATACACGCCAGTGACGAGAATTATTGCCTGGATGGAACCTTCCAAGCAAATTTGATCTTTTATGTCTGGCCAATCGATTGCACGAGATGAGAATTTATAATGTTATTAGATTTTGTTATATTAATTGTATTATTTGGTACGTCTCGCTCGTCATTGGGTATATCA