Terminator 3

Terminator ID
3
Name
ENO2t
Type
terp
Sequence
AGTGCTTTTAACTAAGAATTATTAGTCTTTTCTGCTTATTTTTTCATCATAGTTTAGAACACTTTATATTAACGAATAGTTTATGAATCTATTTAGGTTTAAAAATTGATACAGTTTTATAAGTTACTTTTTCAAAGACTCGTGCTGTCTATTGCATAATGCACTGGAAGGGGAAAAAAAAGGTGCACACGCGTGGCTTTTTCTTGAATTTGCAGTTTGAAAAATAACTACATGGATGATAAGAAAACATGGAGTACAGTCACTTTGAGAACCTTCAATCAGCTGGTAACGTCTTCGTTAATTGGATACTCAAAAAAGATGGATAGCATGAATCACAAGATGGAAGGAAATGCGGGCCACGACCACAGTGATATGCATATGGGAGATGGAGATGATACCT