Terminator 5

Terminator ID
5
Name
PGI1t
Type
terp
Sequence
ACAAATCGCTCTTAAATATATACCTAAAGAACATTAAAGCTATATTATAAGCAAAGATACGTAAATTTTGCTTATATTATTATACACATATCATATTTCTATATTTTTAAGATTTGGTTATATAATGTACGTAATGCAAAGGAAATAAATTTTATACATTATTGAACAGCGTCCAAGTAACTACATTATGTGCACTAATAGTTTAGCGTCGTGAAGACTTTATTGTGTCGCGAAAAGTAAAAATTTTAAAAATTAGAGCACCTTGAACTTGCGAAAAAGGTTCTCATCAACTGTTTAAAAGGAGGATATCAGGTCCTATTTCTGACAAACAATATACAAATTTAGTTTCAAAGATGAATCAGTGCGCGAAGGACATAACTCA