Terminator 6

Terminator ID
6
Name
TDH2t
Type
terp
Sequence
ATTTAACTCCTTAAGTTACTTTAATGATTTAGTTTTTATTATTAATAATTCATGCTCATGACATCTCATATACACGTTTATAAAACTTAAATAGATTGAAAATGTATTAAAGATTCCTCAGGGATTCGATTTTTTTGGAAGTTTTTGTTTTTTTTTCCTTGAGATGCTGTAGTATTTGGGAACAATTATACAATCGAAAGATATATGCTTACATTCGACCGTTTTAGCCGTGATCATTATCCTATAGTAACATAACCTGAAGCATAACTGACACTACTATCATCAATACTTGTCACATGAGAACTCTGTGAATAATTAGGCCACTGAAATTTGATGCCTGAAGGACCGGCATCACGGATTTTCGATAAAGCACTTAGTATCACACTAATTGGCTTTTCGC